shRNA Adeno-associated Virus Serotype 2, pH1-(1700001C02Rik-shRNA-Seq1)(CAT#: AAV-SI3156WQ)

This product is a 1700047H18Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 1700047H18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 1700001C02Rik-shRNA-Seq1
Related Target/Protein 1700001C02Rik
Region CDS
TargetSeq CTTCCTCCTTTGGCTCTTCTT
NCBI RefSeq NM_029285
Alternative Names 1700047H18Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75434
Uniprot ID D3Z6F6

Related Products