shRNA Adeno-associated Virus Serotype 2, pH1-(Adipor1-shRNA-Seq2)(CAT#: AAV-SI2684WQ)

This product is a Adipor1-shRNA encoding AAV, which is based on AAV-2 serotype. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Adipor1-shRNA-Seq2
Related Target/Protein Adipor1
Region CDS
TargetSeq GCTGAAAGACAACGACTACCT
NCBI RefSeq NM_028320
Alternative Names CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A
Titer >1*10^10 GC/mL
Related Diseases Obesity; Diabetes
Target Gene
Gene ID 51094
Uniprot ID Q96A54

Related Products