shRNA Adeno-associated Virus Serotype 2, pH1-(CAMSAP1-shRNA-Seq1)(CAT#: AAV-SI0803WQ)

This product is a CAMSAP1-shRNA encoding AAV, which is based on AAV-2 serotype. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CAMSAP1-shRNA-Seq1
Related Target/Protein CAMSAP1
Region CDS
TargetSeq GAAAGCAATCAGCGGACACTT
NCBI RefSeq NM_015447
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 157922
Uniprot ID Q5T5Y3

Related Products