shRNA Adeno-associated Virus Serotype 2, pH1-(Csn1s2a-shRNA-Seq3)(CAT#: AAV-SI2695WQ)

This product is a Csn1s2a-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Csn1s2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Csn1s2a-shRNA-Seq3
Related Target/Protein Csn1s2a
Region CDS
TargetSeq GCGTGTTCTTCCAAACAACTA
NCBI RefSeq NM_007785
Alternative Names CSN1S2AP; CSN1S2A
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286828
Uniprot ID Q8IUJ1

Related Products