shRNA Adeno-associated Virus Serotype 2, pH1-(KHDRBS1-shRNA-Seq5)(CAT#: AAV-SI0549WQ)
This product is a KHDRBS1-shRNA encoding AAV, which is based on AAV-2 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KHDRBS1-shRNA-Seq5 |
| Related Target/Protein | KHDRBS1 |
| Region | CDS |
| TargetSeq | GATGAGGAGAATTACTTGGAT |
| NCBI RefSeq | NM_006559 |
| Alternative Names | p62; p68; Sam68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary ovarian insufficiency |