shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA0513-shRNA-Seq1)(CAT#: AAV-SI0744WQ)

This product is a KIAA0513-shRNA encoding AAV, which is based on AAV-2 serotype. KIAA0513, a novel signaling molecule that interacts with modulators of neuroplasticity, apoptosis, and the cytoskeleton. The expression of KIAA0513-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA0513-shRNA-Seq1
Related Target/Protein KIAA0513
Region CDS
TargetSeq CAAGAAGCTGTGCAATGACTT
NCBI RefSeq NM_014732
Titer >1*10^10 GC/mL
Related Diseases Pancreatic carcinoma
Target Gene
Gene ID 9764
Uniprot ID O60268

Related Products