shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA0802-shRNA-Seq1)(CAT#: AAV-SI0682WQ)
This product is a KIAA0802-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KIAA0802-shRNA-Seq1 |
| Related Target/Protein | KIAA0802 |
| Region | CDS |
| TargetSeq | GCTGCTGGAACATGCCTTAAA |
| NCBI RefSeq | NM_015210 |
| Alternative Names | SOGA2; CCDC165; MTCL1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Microtubules (MTs) growth |