shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA1841-shRNA-Seq2)(CAT#: AAV-SI0720WQ)
This product is a KIAA1841-shRNA encoding AAV, which is based on AAV-2 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KIAA1841-shRNA-Seq2 |
Related Target/Protein | KIAA1841 |
Region | CDS |
TargetSeq | CCATGCAACATGAACTGTATT |
NCBI RefSeq | NM_032506 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung adenocarcinoma |