shRNA Adeno-associated Virus Serotype 2, pH1-(Med18-shRNA-Seq3)(CAT#: AAV-SI2730WQ)
This product is a Med18-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Med18-shRNA-Seq3 |
| Related Target/Protein | Med18 |
| Region | CDS |
| TargetSeq | CTCTGATGACATGAGGAACTT |
| NCBI RefSeq | NM_026039 |
| Alternative Names | SRB5; p28b |
| Titer | >1*10^10 GC/mL |