shRNA Adeno-associated Virus Serotype 2, pH1-(OR10A6-shRNA-Seq2)(CAT#: AAV-SI3014WQ)

This product is a OR10A6-shRNA encoding AAV, which is based on AAV-2 serotype. The OR10A6 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10A6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR10A6-shRNA-Seq2
Related Target/Protein OR10A6
Region CDS
TargetSeq CCTGAGTTTCAGTGCAGTTAT
NCBI RefSeq XM_372373
Alternative Names OR11-96
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390093
Uniprot ID Q8NH74

Related Products