shRNA Adeno-associated Virus Serotype 2, pH1-(PRPF18-shRNA-Seq2)(CAT#: AAV-SI0523WQ)

This product is a PRPF18-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRPF18-shRNA-Seq2
Related Target/Protein PRPF18
Region CDS
TargetSeq GAGGAGAACCAATCAGACTAT
NCBI RefSeq NM_003675
Alternative Names PRP18; hPrp18
Titer >1*10^10 GC/mL
Related Diseases late-onset Alzheimer disease (LOAD)
Target Gene
Gene ID 8559
Uniprot ID Q99633

Related Products