shRNA Adeno-associated Virus Serotype 2, pH1-(SH3BP5-shRNA-Seq1)(CAT#: AAV-SI0937WQ)
This product is a SH3BP5-shRNA encoding AAV, which is based on AAV-2 serotype. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SH3BP5-shRNA-Seq1 |
Related Target/Protein | SH3BP5 |
Region | CDS |
TargetSeq | CCTTTGAAGATGACAGCTGTA |
NCBI RefSeq | NM_004844 |
Alternative Names | SAB; SH3BP-5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute Liver Failure |