shRNA Adeno-associated Virus Serotype 2, pH1-(TMEM156-shRNA-Seq1)(CAT#: AAV-SI0660WQ)
This product is a TMEM156-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM156 is expressed in several tissues including ascites, bone marrow, salivary glands, and vascular to name a few. It should be noted this gene is not ubiquitously expressed, but is still evident in many tissues. This gene is predominately expressed in adults but there is a bit of expression in fetuses. The expression of TMEM156-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TMEM156-shRNA-Seq1 |
| Related Target/Protein | TMEM156 |
| Region | CDS |
| TargetSeq | GAAGTGTGTTTGCAATCTAAT |
| NCBI RefSeq | NM_024943 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer, liver cancer and prostate cancer |