shRNA Adeno-associated Virus Serotype 2, pH1-(TSR2-shRNA-Seq1)(CAT#: AAV-SI0782WQ)
This product is a TSR2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by TSR2 gene appears to repress the transcription of NF-kappaB and may be involved in apoptosis. Defects in this gene are a cause of Diamond-Blackfan anemia. The expression of TSR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TSR2-shRNA-Seq1 |
Related Target/Protein | TSR2 |
Region | CDS |
TargetSeq | GAGGTCACAGCTACGAATGAT |
NCBI RefSeq | NM_058163 |
Alternative Names | WGG1; DBA14; DT1P1A10 |
Titer | >1*10^10 GC/mL |
Related Diseases | Diamond-Blackfan anemia |