shRNA Adeno-associated Virus Serotype 2, pU6-(Btla-shRNA-Seq4)(CAT#: AAV-SI1731WQ)
This product is a Btla-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Btla-shRNA-Seq4 |
| Related Target/Protein | Btla |
| Region | 3UTR |
| TargetSeq | CCTGGAAATAAGACAAGAGAA |
| NCBI RefSeq | NM_177584 |
| Alternative Names | BTLA1; CD272 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Rheumatoid arthritis. |