shRNA Adeno-associated Virus Serotype 2, pU6-(CIAPIN1-shRNA-Seq1)(CAT#: AAV-SI0274WQ)
This product is a CIAPIN1-shRNA encoding AAV, which is based on AAV-2 serotype. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CIAPIN1-shRNA-Seq1 |
Related Target/Protein | CIAPIN1 |
Region | 3UTR |
TargetSeq | GAGTTGTTAGTTTACTCCATT |
NCBI RefSeq | NM_020313 |
Alternative Names | DRE2; CIAE2; PRO0915; Anamorsin |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |