shRNA Adeno-associated Virus Serotype 2, pU6-(CREG2-shRNA-Seq2)(CAT#: AAV-SI0234WQ)
This product is a CREG2-shRNA encoding AAV, which is based on AAV-2 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CREG2-shRNA-Seq2 |
Related Target/Protein | CREG2 |
Region | CDS |
TargetSeq | CCTCGCTGATGCTGCCAGAAT |
NCBI RefSeq | NM_153836 |
Titer | >1*10^10 GC/mL |
Related Diseases | Brain disease |