shRNA Adeno-associated Virus Serotype 2, pU6-(Csrnp1-shRNA-Seq3)(CAT#: AAV-SI1766WQ)
This product is a Csrnp1-shRNA encoding AAV, which is based on AAV-2 serotype. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Csrnp1-shRNA-Seq3 |
| Related Target/Protein | Csrnp1 |
| Region | 3UTR |
| TargetSeq | GTTTATGGCTGCTCTATTAAA |
| NCBI RefSeq | NM_153287 |
| Alternative Names | AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |