shRNA Adeno-associated Virus Serotype 2, pU6-(Fam110b-shRNA-Seq1)(CAT#: AAV-SI2213WQ)
This product is a Fam110b-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Fam110b gene may be involved in tumor progression. The expression of Fam110b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Fam110b-shRNA-Seq1 |
| Related Target/Protein | Fam110b |
| Region | CDS |
| TargetSeq | CAGACTTGAGTGACAGGTATT |
| NCBI RefSeq | NM_173426 |
| Alternative Names | C8orf72 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
