shRNA Adeno-associated Virus Serotype 2, pU6-(Lamtor2-shRNA-Seq1)(CAT#: AAV-SI2346WQ)
This product is a Lamtor2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Lamtor2-shRNA-Seq1 |
| Related Target/Protein | Lamtor2 |
| Region | CDS |
| TargetSeq | GCTGAATAATGAGGGATCGCT |
| NCBI RefSeq | NM_031248 |
| Alternative Names | p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary immunodeficiency syndrome |
