shRNA Adeno-associated Virus Serotype 2, p7SK-(Bex2-shRNA-Seq1)(CAT#: AAV-SI3938WQ)

This product is a Bex2-shRNA encoding AAV, which is based on AAV-2 serotype. The Bex2 gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. The expression of Bex2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Bex2-shRNA-Seq1
Related Target/Protein Bex2
Region 3UTR
TargetSeq GTTTGTGATGTACTGTTGTAA
NCBI RefSeq NM_009749
Alternative Names BEX1; DJ79P11.1
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 84707
Uniprot ID Q9BXY8

Related Products