shRNA Adeno-associated Virus Serotype 2, pU6-(LOC392563-shRNA-Seq1)(CAT#: AAV-SI1564WQ)
This product is a LOC392563-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LOC392563-shRNA-Seq1 |
| Related Target/Protein | LOC392563 |
| Region | CDS |
| TargetSeq | CCGCGGTATTTCGTGGAATAA |
| NCBI RefSeq | XM_373382 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurodegenerative diseases |
