shRNA Adeno-associated Virus Serotype 2, pU6-(LY6G6D-shRNA-Seq1)(CAT#: AAV-SI0167WQ)
This product is a LY6G6D-shRNA encoding AAV, which is based on AAV-2 serotype. LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes and most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction. The expression of LY6G6D-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LY6G6D-shRNA-Seq1 |
Related Target/Protein | LY6G6D |
Region | CDS |
TargetSeq | GACAACATGCAGGCCATCTAT |
NCBI RefSeq | NM_021246 |
Alternative Names | G6D; NG25; LY6-D; MEGT1; C6orf23 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |