shRNA Adeno-associated Virus Serotype 2, pU6-(LY6G6D-shRNA-Seq1)(CAT#: AAV-SI0167WQ)
This product is a LY6G6D-shRNA encoding AAV, which is based on AAV-2 serotype. LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes and most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction. The expression of LY6G6D-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LY6G6D-shRNA-Seq1 |
| Related Target/Protein | LY6G6D |
| Region | CDS |
| TargetSeq | GACAACATGCAGGCCATCTAT |
| NCBI RefSeq | NM_021246 |
| Alternative Names | G6D; NG25; LY6-D; MEGT1; C6orf23 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |