shRNA Adeno-associated Virus Serotype 2, pU6-(MFSD6L-shRNA-Seq1)(CAT#: AAV-SI2091WQ)

This product is a MFSD6L-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of MFSD6L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MFSD6L-shRNA-Seq1
Related Target/Protein MFSD6L
Region CDS
TargetSeq GAACTTTCTGTTCTGGCACAT
NCBI RefSeq NM_152599
Titer >1*10^10 GC/mL
Target Gene
Gene ID 162387
Uniprot ID Q8IWD5

Related Products