shRNA Adeno-associated Virus Serotype 2, pU6-(PRRC1-shRNA-Seq2)(CAT#: AAV-SI0179WQ)

This product is a PRRC1-shRNA encoding AAV, which is based on AAV-2 serotype. PRRC1 Belongs to the PRRC1 family. 5 isoforms of the human protein are produced by alternative splicing. The expression of PRRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRRC1-shRNA-Seq2
Related Target/Protein PRRC1
Region CDS
TargetSeq GTGACCTCAAATAAAGAAGTA
NCBI RefSeq NM_130809
Titer >1*10^10 GC/mL
Related Diseases Head and neck cancer
Target Gene
Gene ID 133619
Uniprot ID Q96M27

Related Products