shRNA Adeno-associated Virus Serotype 2, pU6-(SPATA19-shRNA-Seq1)(CAT#: AAV-SI0164WQ)
This product is a SPATA19-shRNA encoding AAV, which is based on AAV-2 serotype. The SPATA19 may have a role in spermiogenesis. The expression of SPATA19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SPATA19-shRNA-Seq1 |
Related Target/Protein | SPATA19 |
Region | CDS |
TargetSeq | CGGACATTGACGTTGTGGAAA |
NCBI RefSeq | NM_174927 |
Alternative Names | CT132; SPAS1; spergen1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Spermiogenesis |