shRNA Adeno-associated Virus Serotype 2, pU6-(TXNDC5-shRNA-Seq1)(CAT#: AAV-SI1616WQ)
This product is a TXNDC5-shRNA encoding AAV, which is based on AAV-2 serotype. The TXNDC5 gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The expression of TXNDC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TXNDC5-shRNA-Seq1 |
| Related Target/Protein | TXNDC5 |
| Region | CDS |
| TargetSeq | CGAAACTGTCAAGATTGGCAA |
| NCBI RefSeq | NM_022085 |
| Alternative Names | HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Disulfide-isomerase deficiency |