shRNA Adeno-associated Virus Serotype 2, pU6-(WDR74-shRNA-Seq3)(CAT#: AAV-SI0453WQ)
This product is a WDR74-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | WDR74-shRNA-Seq3 |
Related Target/Protein | WDR74 |
Region | CDS |
TargetSeq | GTGGGAAAGAGAATGCTTTGA |
NCBI RefSeq | NM_018093 |
Alternative Names | Nsa1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mammary adenocarcinoma |