shRNA Adeno-associated Virus Serotype 2, pU6-(Zfand2a-shRNA-Seq1)(CAT#: AAV-SI2216WQ)
This product is a Zfand2a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zfand2a gene has zinc ion binding ability. The expression of Zfand2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Zfand2a-shRNA-Seq1 |
Related Target/Protein | Zfand2a |
Region | CDS |
TargetSeq | CAATAACATGCGACGCCTGTA |
NCBI RefSeq | NM_133349 |
Alternative Names | AIRAP |
Titer | >1*10^10 GC/mL |