shRNA Adeno-associated Virus Serotype 2, pU6-(ZNF714-shRNA-Seq1)(CAT#: AAV-SI0348WQ)

This product is a ZNF714-shRNA encoding AAV, which is based on AAV-2 serotype. The ZNF714 gene may be involved in transcriptional regulation. The expression of ZNF714-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZNF714-shRNA-Seq1
Related Target/Protein ZNF714
Region 3UTR
TargetSeq GCCTTTAACAAGCCCTCAATT
NCBI RefSeq NM_182515
Titer >1*10^10 GC/mL
Related Diseases Type 1 diabetes
Target Gene
Gene ID 148206
Uniprot ID Q96N38

Related Products