shRNA Adeno-associated Virus Serotype 2, p7SK-(2510006D16Rik-shRNA-Seq1)(CAT#: AAV-SI3925WQ)
This product is a 2510006D16Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2510006D16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 2510006D16Rik-shRNA-Seq1 |
| Related Target/Protein | 2510006D16Rik |
| Region | CDS |
| TargetSeq | GAAGATATTGGTGGGAAAGAA |
| NCBI RefSeq | NM_029748 |
| Alternative Names | 1500002D11Rik; Tmem234; 4933407D05Rik |
| Titer | >1*10^10 GC/mL |
