shRNA Adeno-associated Virus Serotype 2, p7SK-(2510006D16Rik-shRNA-Seq1)(CAT#: AAV-SI3925WQ)

This product is a 2510006D16Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2510006D16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2510006D16Rik-shRNA-Seq1
Related Target/Protein 2510006D16Rik
Region CDS
TargetSeq GAAGATATTGGTGGGAAAGAA
NCBI RefSeq NM_029748
Alternative Names 1500002D11Rik; Tmem234; 4933407D05Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 76799
Uniprot ID G3UZQ3

Related Products