shRNA Adeno-associated Virus Serotype 2, p7SK-(Cyb5d2-shRNA-Seq6)(CAT#: AAV-SI3741WQ)
This product is a Cyb5d2-shRNA encoding AAV, which is based on AAV-2 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Cyb5d2-shRNA-Seq6 |
| Related Target/Protein | Cyb5d2 |
| Region | CDS |
| TargetSeq | CCCAGGAAGTTGTATAAGCCA |
| NCBI RefSeq | XM_109819 |
| Alternative Names | CYB5D2 |
| Titer | >1*10^10 GC/mL |