shRNA Adeno-associated Virus Serotype 2, p7SK-(MUM1L1-shRNA-Seq2)(CAT#: AAV-SI1457WQ)
This product is a MUM1L1-shRNA encoding AAV, which is based on AAV-2 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MUM1L1-shRNA-Seq2 |
| Related Target/Protein | MUM1L1 |
| Region | 3UTR |
| TargetSeq | CCAGAATCTGAGAATTTGGAA |
| NCBI RefSeq | NM_152423 |
| Alternative Names | MUM1L1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Endometrial carcinoma |
