shRNA Adeno-associated Virus Serotype 2, p7SK-(ZDHHC19-shRNA-Seq2)(CAT#: AAV-SI1081WQ)
This product is a ZDHHC19-shRNA encoding AAV, which is based on AAV-2 serotype. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | ZDHHC19-shRNA-Seq2 |
Related Target/Protein | ZDHHC19 |
Region | CDS |
TargetSeq | CTGGCATCTTACATCAAGGCT |
NCBI RefSeq | NM_144637 |
Alternative Names | DHHC19 |
Titer | >1*10^10 GC/mL |
Related Diseases | Liver cancer |