shRNA Adeno-associated Virus Serotype 2, pH1-(Adm2-shRNA-Seq4)(CAT#: AAV-SI2814WQ)
This product is a Adm2-shRNA encoding AAV, which is based on AAV-2 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Adm2-shRNA-Seq4 |
| Related Target/Protein | Adm2 |
| Region | CDS |
| TargetSeq | GATTCCTTCCAGTAACCTGCA |
| NCBI RefSeq | NM_182928 |
| Alternative Names | AM2; dJ579N16.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Gastrointestinal and cardiovascular disease |