shRNA Adeno-associated Virus Serotype 2, pH1-(NCRNA00173-shRNA-Seq2)(CAT#: AAV-SI0940WQ)

This product is a NCRNA00173-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of NCRNA00173-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert NCRNA00173-shRNA-Seq2
Related Target/Protein NCRNA00173
Region CDS
TargetSeq GTTCAAATTCTGGTTCTGCTA
NCBI RefSeq NM_207436
Alternative Names LINC00173
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 100287569
Uniprot ID Q6ZV60

Related Products