shRNA Adeno-associated Virus Serotype 2, pH1-(RNPS1-shRNA-Seq1)(CAT#: AAV-SI0550WQ)

This product is a RNPS1-shRNA encoding AAV, which is based on AAV-2 serotype. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert RNPS1-shRNA-Seq1
Related Target/Protein RNPS1
Region 3UTR
TargetSeq GAAGACCAGTAGGAAAGCAAA
NCBI RefSeq NM_006711
Alternative Names E5.1
Titer >1*10^10 GC/mL
Related Diseases Neuro-developmental disorders
Target Gene
Gene ID 10921
Uniprot ID Q15287

Related Products