shRNA Adeno-associated Virus Serotype 2, pU6-(Hexim1-shRNA-Seq1)(CAT#: AAV-SI2280WQ)
This product is a Hexim1-shRNA encoding AAV, which is based on AAV-2 serotype. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Hexim1-shRNA-Seq1 |
| Related Target/Protein | Hexim1 |
| Region | 3UTR |
| TargetSeq | GCCAAGATAAACTTGTGAGAA |
| NCBI RefSeq | NM_138753 |
| Alternative Names | CLP1; EDG1; HIS1; MAQ1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Viral infection |